This algorithm is an parallel longest common subsequence implementation. It works by dividing the backtrack matrix into several parts. These parts depend on up to two other parts similar to the … more

As a follow-up for the "longest common subsequence" posts, I've coded a diff-algorithm based on the code of the F# version of LCS.

Usage

let a = "CACCCCTAAGGTACCTTTGGTTC" … more

C# version

Problem

The "longest common subsequence" problem is to find the longest common subsequence between 2 or more strings. This should not be confused with "longest common substring" problem … more

Note: This is an adapted version of the longest common subsequence for C# available at Wikibooks. However, the ReadLCSFromBacktrack method appearing on Wikibooks is flawed (at the time of … more

Often it is very useful to have access to the index of an object in a list. This is useful in LINQ as well as in a regular foreach-loop. It can be done with the extended Select-statement in LINQ like … more

Here is an extension method which returns a sequence of chunks (of an IEnumerable<T>).

Usage

If you don't want an array, as the last item, with the remaining of the sequence (when … more

Here is a small extension method which basically interleave two IEnumerable<T>. If they are not of equal length, the rest of the longest will be appended.

Usage … more

For a particular project I needed a invisible captcha. I didn't want to use something like REcaptcha because it is too cumbersome for users. Therefore did I develop this solution. This, however, is … more